PRO/PL> Viroids, peach - Czech Republic: 1st report

VIROIDS, PEACH - CZECH REPUBLIC: FIRST REPORT
*********************************************
A ProMED-mail post
<http://www.promedmail.org>
ProMED-mail is a program of the
International Society for Infectious Diseases
<http://www.isid.org>

Date: 25 Nov 2003
From: ProMED-mail<[EMAIL PROTECTED]>
American Phytopathological Society, Plant Disease Notes [edited]


1st Report of Peach latent mosaic viroid and Hop stunt viroid 
Infecting Peach Trees in the Czech Republic.

M. Hassan and P. Rysanek, Department of Plant Protection, Czech 
University of Agriculture, Prague, Czech Republic; and F. Di Serio, 
Institute of Plant Virology, CNR, Bari, Italy. This work was 
supported from the grant QC1359 of the Ministry of Agriculture of the 
Czech Republic. Plant Dis. 87:1537, 2003; published on-line as 
D-2003-1002-01N, 2003. Accepted for publication 12 Sep 2003.

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are 
known to naturally infect stone fruits, but their contemporary 
presence in peach trees has been reported only recently (3).

During a field validation of detection methods developed for sanitary 
screening of propagation material, PLMVd and HSVd, alone or in mixed 
infections, were detected in peach trees grown in the trial orchard 
of the Czech University of Agriculture in Prague.

Leaf samples were collected in September 2002 from symptomless trees 
of peach cultivars imported from the United States (cvs. Sunhaven, 
Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), 
Slovakia (cv. Luna), and a tree of Chinese wild peach, _Prunus 
davidiana_, and analyzed by reverse transcription-polymerase chain 
reaction (RT-PCR).

PLMVd cDNA was amplified as previously reported (2) or by using 2 
sets of primer pairs designed to amplify partial cDNAs, one reverse 
primer R: GTTACTACGGCGGTACCTGA, complementary to the nucleotide 
positions 204 to 223 and forward primers F1:CGTATCTCAACGCCTCATCA, 
homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, 
homologous to the positions 15 to 34 of PLMVd reference sequence (2).

The 2 pairs using the R sequence produced the expected size PCR 
products of 115 and 209 bp, respectively. RT-PCR for HSVd detection 
was performed as reported (1). The same total RNA preparations were 
also analyzed by molecular hybridization with nonisotopic riboprobes 
specific for each viroid. With minor exceptions, both methods gave 
similar results.

Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with 
PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants 
included cvs. Luna, Cresthaven, Dixired, and Halehaven and the 
species _P. davidiana_. The high number of infections by both viroids 
was unexpected because mixed infections are generally rare (3). Most 
likely, mixed infections occurred during field manipulations and 
propagation of infected materials.

To our knowledge, this is the first report of PLMVd in the Czech 
Republic. Although further investigations are needed to ascertain the 
spread of stone fruit viroids in the Czech Republic, our results also 
report an unusually high incidence of mixed infections of peach trees 
in this country. These results stress the need for a certification 
program to help control the spread of stone fruit viroids in the 
Czech Republic.

References:
(1) K. Amari et al. J. Gen. Virol. 82:953, 2001.
(2) A. M. Shamloul et al. Acta Hort. 386:522, 1995.
(3) M. Tessitori et al. Plant Dis. 86:329, 2001.

------------------------------------------------------------------------
ProMED-mail
<[EMAIL PROTECTED]>

[Viroids are extremely infectious pathogens. These circular, 
single-stranded covalent circles share extensive intramolecular base 
pairing, which confers resistance to nucleases in plant tissues. 
PLMVd is transmitted by grafting and by aphids (_Myzus persicae_) but 
not by mites or pollen. HSVd causes a severe disease in hop (_Humulus 
lupulus_), and strains of the viroid have been recognized in 
cucumber, grapevine, citron, peach, and plum. Both viroids are also 
easily transmitted by grafting or by use of contaminated pruning 
tools, but evidence of their transmission by vectors is apparently 
lacking for HSVd. Viroid disease management depends upon sanitation; 
plant viroid-free trees, sterilize shears after pruning each tree, 
and eradicate infected trees.

References:
<http://nrsp5.prosser.wsu.edu/nrspres1.html>
<http://www3.res.bbsrc.ac.uk/webdpv/web/adpv.asp?dpvnum=362>
<http://www3.res.bbsrc.ac.uk/webdpv/web/adpv.asp?dpvnum=326>
<http://www.actahort.org/books/386/386_89.htm> - Mod.DH]

[see also:
2002
----
Peach latent mosaic viroid - Uruguay: first report 20021129.5931
Hop stunt and Peach latent mosaic viroids, peach - Italy 20020305.3688]
.......................................dh/pg/lm
*##########################################################*
ProMED-mail makes every effort to  verify  the reports  that
are  posted,  but  the  accuracy  and  completeness  of  the
information,   and  of  any  statements  or  opinions  based
thereon, are not guaranteed. The reader assumes all risks in
using information posted or archived by  ProMED-mail.   ISID
and  its  associated  service  providers  shall not be  held
responsible for errors or omissions or  held liable for  any
damages incurred as a result of use or reliance upon  posted
or archived material.
************************************************************
*                                                          *
*   Please support the 2003 ProMED-mail Internet-a-thon!   *
*        http://www.isid.org/netathon2003.shtml            *
*                                                          *
************************************************************
Visit ProMED-mail's web site at <http://www.promedmail.org>.
Send  all  items  for   posting  to:   [EMAIL PROTECTED]
(NOT to  an  individual moderator).  If you do not give your
full name and  affiliation, it  may  not  be  posted.   Send
commands  to  subscribe/unsubscribe,   get  archives,  help,
etc. to: [EMAIL PROTECTED]    For assistance  from a
human  being  send  mail  to:   [EMAIL PROTECTED]
############################################################
############################################################